Human PDGF-D/PDGFD transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_025208.4

RefSeq ORF Size

1113bp

Gene Synonym

PDGFD, IEGF, MGC26867, MSTP036, SCDGF-B.

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human platelet derived growth factor D (PDGFD), transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Platelet-derived growth factor D (PDGF-D), also known as Iris-expressed growth factor, is a member of the PDGF/vascular endothelial growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. PDGF-D/PDGFD only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. The expression of PDGF-D/PDGFD in the eye is tissue-specific. In the anterior segment, it is localized to iris and ciliary body, whereas in the retina, PDGF-D/PDGFD is restricted to the outer plexiform layer. PDGF-D/PDGFD is present in aqueous humor but is not detectable in mature lens or in mouse lens-derived alphaTN4-1 cells. PDGF-D/PDGFD is highly expressed in human breast cancer and facilitates tumor growth and lymph node metastasis, making it a potential target in breast cancer. PDGF-D/PDGFD increases drug delivery and hence improves the efficacy of chemotherapy through vessel normalization. Intervention in the PDGF-D pathway in the eye, perhaps by antibody or blocking peptide, could be useful in the treatment of certain cataracts, including post-operative secondary cataract.

References

Ray S, et al. (2005) Platelet-derived growth factor D, tissue-specific expression in the eye, and a key role in control of lens epithelial cell proliferation. J Biol Chem. 280(9): 8494-502.

Uutela M, et al. (2004) PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104 (10): 3198-204.

Taneda S, et al. (2004) Obstructive uropathy in mice and humans: potential role for PDGF-D in the progression of tubulointerstitial injury. J Am Soc Nephrol. 14 (10): 2544-55.

Catalog Number:HGF709-NY