Human PDE2A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF698-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2826bp
Gene Synonym
PDE2A1, PED2A4, PDE2A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphodiesterase 2A, cGMP-stimulated Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
cGMP-dependent 3',5'-cyclic phosphodiesterase, also known as cyclic GMP-stimulated phosphodiesterase and PDE2A, is a peripheral membrane protein which belongs to the cyclic nucleotide phosphodiesterase family and PDE2 subfamily. Phosphodiesterases (PDEs) comprise a family of enzymes that regulate the levels of cyclic nucleotides, key second messengers that mediate a diverse array of functions. Phosphodiesterases (PDEs) modulate signaling by cyclic nucleotides in diverse processes such as cardiac contractility, platelet aggregation, lipolysis, glycogenolysis, and smooth muscle contraction. PDE2A is an evolutionarily conserved cGMP-stimulated cAMP and cGMP PDE. PDE2A contains two GAF domains. PDE2A is expressed in brain and to a lesser extent in heart, placenta, lung, skeletal muscle, kidney and pancreas. PDE2A is a cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. PDE2A is involved in the regulation of blood pressure and fluid homeostasis by the atrial natriuretic peptide (ANP), making PDE2-type enzymes important targets for drug discovery.
References
  • Iffland,A. et al., 2005, Biochemistry. 44 (23):8312-25
  • de Oliveira,S.K. et al., 2007,J Biol Chem. 282 (18):13656-63.
  • Stephenson,D.T. et al., 2009, J Histochem Cytochem. 57 (10):933-49.
  • Russwurm,C. et al., 2009, J Biol Chem. 284 (38):25782-90.
  • TOP