Rat PD-L2/B7-DC/CD273 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGF686-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
807bp
Gene Synonym
Pdcd1lg2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat programmedcelldeath1ligand2 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.
References
  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.
  • TOP