Human Pancreasin/Marapsin/PRSS27 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGF606-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
873bp
Gene Synonym
MPN, CAPH2, PRSS27
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protease, serine 27 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The name "Pancreasin" because it is transcribed strongly in the pancreas. This secreted, tryptic serine protease, also known as Marapsin or PRSS27 (Protease, serine, 27), which is a member of the peptidase S1 family. Pancreasin is inhibited by benzamidine and leupeptin but resists several classic inhibitors of trypsin. Marapsin was constitutively expressed in nonkeratinizing stratified squamous epithelia of human esophagus, tonsil, cervix, larynx, and cornea. In fact, marapsin was the second most strongly up-regulated protease in psoriatic lesions, where expression was localized to the upper region of the hyperplastic epidermis. Similarly, in the hyperproliferative epithelium of regenerating murine skin wounds, marapsin localized to the suprabasal layers, where keratinocytes undergo squamous differentiation. Marapsin's restricted expression, localization, and cytokine-inducible expression suggest a role in the terminal differentiation of keratinocytes in hyperproliferating squamous epithelia.
References
  • Bhagwandin VJ, et al. (2003) Structure and activity of human pancreasin, a novel tryptic serine peptidase expressed primarily by the pancreas. J Biol Chem. 278(5): 3363-71.
  • Li W, et al. (2009) The serine protease marapsin is expressed in stratified squamous epithelia and is up-regulated in the hyperproliferative epidermis of psoriasis and regenerating wounds. J Biol Chem. 284(1): 218-28.
  • TOP