Human p63 / TP63 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

RefSeq ORF Size

2043bp

Gene Synonym

AIS, KET, LMS, NBP, RHS, p40, p51, p63, EEC3, OFC8, p73H, p73L, SHFM4, TP53L, TP73L, p53CP, TP53CP, B(p51A), B(p51B), TP63

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human tumor protein p63 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor protein p63 is a protein also known as transformation-related protein 63, TP63, and p63. Tumor protein p63 / p63 is a member of the p53 family of transcription factors whose members P53, p63, and p73 have similar features in their gene structures and functions. An animal model, p63-/- mice has been useful in difining the role p63 plays in the development and maintenance of stratified epithelial tissues. This p63 encoding protein p63 has a dramatic impact on replenishment of cutaneous epithelial stem cells and on ovarian germ cell survival. Although these two fundamental roles of p63 attest to its powerful place in development, its other functions, specifically the apparent capacity of p63, is to supervise the emergence of new cell populations in the breast, prostate, cervix, and upper reproductive tract. P63-/- mice have several development defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Mutations in this protein are associated with ectodermal dysplasia, and cleft lip / palate syndrome 3, ADULT syndrome (acro-dermato-ungual-lacrimal-tooth), limb-mammary syndrome, et al.

References

Crum CP, et al. (2010) p63 in epithelial survival, germ cell surveillance, and neoplasia. Annu Rev Pathol. 5: 349-71.

Tan M, et al. (2001) p53CP is p51/p63, the third member of the p53 gene family: partial purification and characterization. Carcinogenesis. 22 (2): 295-300.

Shiran MS, et al. (2007) p63 as a complementary basal cell specific marker to high molecular weight-cytokeratin in distinguishing prostatic carcinoma from benign prostatic lesions. Med J Malaysia. 62 (1): 36-9.

Catalog Number:HGF579-NF