Mouse OSTM1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF542-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1017bp
Gene Synonym
gl, HSPC019, 1200002H13Rik
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse osteopetrosis associated transmembrane protein 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I  membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).
References

1.  Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2.  Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3.  Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4.  Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5.  Feigin, ME.et al., 2008, Cell Signal. 20 (5): 949-957.  

6.  Pata, M.et al., 2008, J Biol Chem. 283 (45): 30522-30530. 

TOP