Human OSMR/IL-31RB transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_003999.1

RefSeq ORF Size

2940bp

Gene Synonym

OSMRB, MGC75127, MGC150626, MGC150627,

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human oncostatin M receptor1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

References

Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.

Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.

Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.

Catalog Number:HGF534-CO