Human Noggin/NOG Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF326-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
NOG, SYM1, SYNS1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human noggin Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Noggin is a secreted protein involved at multiple stages of vertebrate embryonic development including neural induction and is known to exert its effects by inhibiting the bone morphogenetic protein (BMP)-signaling pathway. It binds several BMPs with very high (picomolar) affinities, with a marked preference for BMP2 and BMP4 over BMP7. By binding tightly to BMPs, Noggin prevents BMPs from binding their receptors. Noggin binds the bone morphogenetic proteins (BMP) such as BMP-4 and BMP-7, and inhibits BMP signaling by blocking the molecular interfaces of the binding epitopes for both type I and type II receptors. Interaction of BMP and its antagonist Noggin governs various developmental and cellular processes, including embryonic dorsal-ventral axis, induction of neural tissue, formation of joints in the skeletal system and neurogenesis in the adult brain. Noggin plays a key role in neural induction by inhibiting BMP4, along with other TGF-β signaling inhibitors such as chordin and follistatin. Mouse knockout experiments have demonstrated that noggin also plays a crucial role in bone development, joint formation, and neural tube fusion.
References
  • Zimmerman LB, et al. (1996) The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell. 86(4): 599-606.
  • Chandramore K, et al. (2010) Cloning of noggin gene from hydra and analysis of its functional conservation using Xenopus laevis embryos. Evol Dev. 12(3): 267-74.
  • TOP