Human NMNAT2 / NMNAT-2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_015039.2

RefSeq ORF Size

924bp

Gene Synonym

PNAT2, C1orf15, MGC2756, KIAA0479, NMNAT2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human nicotinamide nucleotide adenylyltransferase 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

NMNAT2, also known as NMNAT-2, belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family. NMNAT is a central enzyme in NAD+ biosynthesis, transferring the adenylyl moiety of ATP to nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) resulting in the formation of NAD+ or NaAD+ and the release of pyrophosphate. NMNAT2 is predominantly expressed in human pancreas, insulinoma as well as in the brain, especially in the cerebrum, cerebellum, occipital lobe, frontal lobe, temporal lobe and putamen. Immunofluorescence microscopy localized endogenous NMNAT2 to the Golgi apparatus in human cell line. Endogenous NMNAT2 seem to be a labile axon survival factor, because specific depletion of NMNAT2 is sufficient to induce Wallerian-like degeneration of uninjured axons which endogenous NMNAT1 and NMNAT3 cannot prevent. Thus endogenous NMNAT2 represents an exciting new therapeutic target for axonal disorders.

References

Ljungberg MC. et al., 2012, Hum Mol Genet. 21 (2): 251-67.

Seki N. et al., 1998, DNA Res. 4 (5): 345-9.

Raffaelli N. et al., 2002, Biochem Biophys Res Commun. 297 (4): 835-40.

Sood R. et al., 2001, Genomics. 73 (2): 211-22.

Catalog Number:HGF313-NY