Rhesus NKp80 / KLRF1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001032961.1

RefSeq ORF Size

696bp

Gene Synonym

KLRF1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus killer cell lectin-like receptor subfamily F, member 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

NKp80, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp80 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp80, but not NKp80 mutated at tyrosine 7 (NKp80/Y7F), is tyrosine phosphorylated. Accordingly, NKp80/Y7F, but not NKp80/Y30F or NKp80/Y37F, failed to induce cytotoxicity. NKp80 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp80, but not NKp80/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-70 kinase, impaired cytotoxic responses through NKp80. Atypical residues in the hemi-ITAM-like motif of NKp80 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp80 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.

References

Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.

Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.

Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.

Catalog Number:HGF299-NF