Human NGFR/P75 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_002507.2

RefSeq ORF Size

1284bp

Gene Synonym

CD271, p75NTR, TNFRSF16, p75(NTR), Gp80-LNGFR, NGFR

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human nerve growth factor receptor (TNFR superfamily, member 16) Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Nerve growth factor receptors (NGFRs) belong to a large growth factor receptor family. NGFR includes two types of receptors: high-affinity nerve growth factor receptor and low-affinity nerve growth factor receptor. High-affinity nerve growth factor receptor is also referred as Trk familywhose members are bound by some neurotrophins with high affinity. Nerve growth factor binds with TrkA after being released from target cells, the NGF / TrkA complex is subsequently trafficked back to the cell body. The Low-affinity nerve growth factor receptor also named p75 which binds with all kinds of neurotrophins with low affinity. All the four kinds of neurotrophins, including Nerve growth factor, Brain derived neurotrophic factor, Neurotrophin-3, and Neurotrophin-4 bind to the p75. Studies have proved that NGFR acts as a molecular signal swith that determines cell death or survival by three steps. First, pro-nerve growth factor (prNGF) triggers cell apoptosis by its high affinity binding to p75NTR, while NGF induces neuronal survival with low-affinity binding. Second, p75NTR mediates cell death by combining with co-receptor sortilin, whereas it promotes neuronal survival through combination with proNGF. Third, release of the intracellular domain chopper or cleavage short p75 NTR can independently initiate neuronal apoptosis.

References

Chen LW, et al. (2008) The proNGF-p75NTR-sortilin signalling complex as new target for the therapeutic treatment of Parkinson's disease. CNS Neurol Disord Drug Targets. 7(6): 512-23.

Deponti D, et al. (2009) The low-affinity receptor for neurotrophins p75NTR plays a key role for satellite cell function in muscle repair acting via RhoA. Mol Biol Cell.20(16): 3620-7.

Ken-ichiro K, et al. (2004) Necdin-related MAGE proteins differentially interact with the E2F1 transcription factor and the p75 neurotrophin receptor. J Biol Chem. 279 (3): 1703-12.

Catalog Number:HGF268-CO