Rat NGAL/LCN2/Lipocalin-2 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGF262-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
597bp
Gene Synonym
LCN2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat lipocalin 2 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.
References
  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
  • TOP