Mouse Neuroserpin/SerpinI1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF251-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1233bp
Gene Synonym
Ns, PI12, PI-12, Spi17, AI837402, Serpini1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade I, member 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuroserpin, also known as Protease inhibitor 12 and SERPINI1, is a secreted protein which belongs to the serpin family. Neuroserpin is a serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. Neuroserpin is predominantly expressed in the brain, and is expressed in the late stages of neurogenesis during the process of synapse formation. Overexpression of neuroserpin in an anterior pituitary corticotroph cell line results in the extension of neurite-like processes, suggesting that neuroserpin may play a role in cell communication, cell adhesion, and/or cell migration. Neuroserpin may be involved in the formation or reorganization of synaptic connections, as well as synaptic plasticity in the adult nervous system. Neuroserpin may also protect neurons from cell damage by tissue-type plasminogen activator. Defects of neuroserpin are the cause of familial encephalopathy with neuroserpin inclusion bodies (FEN1B).
References
  • Schrimpf SP. et al., 1997, Genomics. 40 (1): 55-62.
  • Hill RM. et al., 2002, Ann N Y Acad Sci. 971: 406-15.
  • Yepes M. et al., 2004, Thromb. Haemost. 91 (3): 457-64.
  • Galliciotti G. et al., 2006, Front Biosci. 11: 33-45.
  • TOP