Human Neuropilin-1/NRP1/CD304 transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGF249-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1935bp
Gene Synonym
NRP1, NP1, NRP, BDCA4, CD304, VEGF165R
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human neuropilin 1, transcript variant 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuropilin is a type I transmembrane protein and the molecular mass is 120 kDa. Two homologues, Neuropilin-1 and Neuropilin-2, are identified. The primary structure of Neuropilin-1 and Neuropilin-2 is well conserved and is divided into four domains, CUB (a1/a2) domain, FV/FVIII (b1/b2) domain, MAM (c) domain, and (d) domain that contains a transmembrane and a short cytoplasmic region. Neuropilin-1 (NRP1) acts as a receptor for two different extracellular ligands, class 3 semaphorins and specific isoforms of vascular endothelial growth factor. The functions of NRP1 and NRP2 have been extensively studied in neurons where they act in axon guidance and in endothelial cells where they promote angiogenesis and cell migration. Neuropilin-1 is likely to mediate contacts between the dendritic cells and the T lymphocytes via homotypic interactions and is essential for the initiation of the primary immune response. NRP1 is a co-receptor for VEGF receptor-2 (VEGFR2) that enhances the binding of VEGF165 to VEGFR2 and VEGF165-mediated chemotaxis. NRP1 expression is regulated in EC by tumor necrosis factor-alpha, the transcription factors dHAND and Ets-1, and vascular injury. NRP1 upregulation is positively correlated with the progression of various tumors. Overexpression of NRPI in rat tumor cells results in enlarged tumors and substantially enhanced tumor angiogenesis. On the other hand, soluble NRP1 (sNRP1) is an antagonist of tumor angiogenesis.
References
  • Nakamura F, et al. (2002) Structural and functional relation of neuropilins. Adv Exp Med Biol. 515: 55-69.
  • Romeo PH, et al. (2002) Neuropilin-1 in the immune system. Adv Exp Med Biol. 515: 49-54.
  • Klagsbrun M, et al. (2002) The role of neuropilin in vascular and tumor biology. Adv Exp Med Biol. 515: 33-48.
  • Staton CA, et al. (2007) Neuropilins in physiological and pathological angiogenesis. J Pathol. 212(3): 237-48.
  • Bagri A, et al. (2009) Neuropilins in tumor biology. Clin Cancer Res. 15(6): 1860-4.
  • TOP