Human Neuroligin 3 / NLGN3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF246-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2487bp
Gene Synonym
HNL3, ASPGX1, AUTSX1, KIAA1480, NLGN3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human neuroligin 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuroligin 3 (NLGN3) is a member of the type-B carboxylesterase/lipase family. Neuroligins (NLGNs) are a family of presumptive postsynaptic cell adhesion molecules. Neuroligins (NLs) constitute a family of cell-surface proteins that interact with neurexins (beta-Nxs), another class of neuronal cell-surface proteins, one of each class functioning together in synapse formation. Neuroligins control the formation and functional balance of excitatory and inhibitory synapses in hippocampal neurons. NLGN1 and NLGN2 isoforms are concentrated at glutamatergic and GABAergic synapses, respectively, but the cellular expression and synaptic localization of the endogenous. NLGN3 was enriched in brain, where NLGN3 protein levels increased during postnatal development, coinciding with the peak of synaptogenesis. The NLGN3 is a synaptic adhesion molecule that is a shared component of glutamatergic and GABAergic synapses. Mutations in NLGN3 gene may be associated with autism and Asperger syndrome.
References
  • Chih B, et al. (2005) Control of excitatory and inhibitory synapse formation by neuroligins. Science. 307(5713): 1324-8.
  • Paraoanu LE, et al. (2006) Expression patterns of neurexin-1 and neuroligins in brain and retina of the chick embryo: Neuroligin-3 is absent in retina. Neurosci Lett. 395(2): 114-7.
  • Budreck EC, et al. (2007) Neuroligin-3 is a neuronal adhesion protein at GABAergic and glutamatergic synapses. Eur J Neurosci. 26(7): 1738-48.
  • TOP