Human nemo-like kinase Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_002946.3

RefSeq ORF Size

1584bp

Gene Synonym

FLJ21033, DKFZp761G1211, NLK

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human nemo-like kinase Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Nemo-like kinase contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. It also contains a TQE activation loop motif in which autophosphorylation of the threonine residue (Thr-298) is sufficient for kinase activation. As a serine/threonine-protein kinase, nemo-like kinase regulates a number of transcription factors with key roles in cell fate determination. It is a positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Nemo-like kinase also is a negative regulator of the canonical Wnt/beta-catenin signaling pathway.

References

Smit L, et al. (2004) Wnt activates the Tak1/Nemo-like kinase pathway. J Biol Chem. 279(17): 17232-40.

Yasuda J, et al. (2004) Nemo-like kinase suppresses a wide range of transcription factors, including nuclear factor-kappaB. Cancer Sci. 95(1):52-7.

Yasuda J, et al. (2003) Nemo-like kinase induces apoptosis in DLD-1 human colon cancer cells. Biochem Biophys Res Commun. 308(2):227-335.

Ishitani T, et al. (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol. 23(4):1379-89.

Catalog Number:HGF234-NY