Mouse NEGR1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGF223-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1047bp
Gene Synonym
Ntra, KILON, mKIAA3001, 5330422G01Rik, Negr1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse neuronal growth regulator 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.
References
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • TOP