Human NCR2/NKp44 /CD336 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGF167-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
831bp
Gene Synonym
LY95, CD336, NKP44, NK-p44, dJ149M18.1, NCR2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human natural cytotoxicity triggering receptor 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Natural cytotoxicity triggering receptor 2 (NCR2), also known as Natural killer cell p44-related protein (NKp44), or CD336, is a member of the natural cytotoxicity receptor (NCR) family, which composed of one Ig-like extracellular domain, a transmembrane segment, and a cytoplasmic domain. It is a novel transmembrane glycoprotein belonging to the Immunoglobulin superfamily characterized by a single extracellular V-type domain. The cytoplasmic domain of NKp44 also contains a sequence that matches the immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus. This Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. NKp44 is selectively expressed by IL-2-activated NK cells and may contribute to the increased efficiency of activated NK cells to mediate tumor cell lysis. Tumor cell recognition of the mutated NKp44 proteins was significantly reduced and correlated with their lower recognition of heparin.
References
  • Vitale M, et al. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 187(12): 2065-72.
  • Cantoni C, et al. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 189: 787-96.
  • Cantoni C, et al. (2003) The three-dimensional structure of the human NK cell receptor NKp44, a triggering partner in natural cytotoxicity. Structure. 11(6): 725-34.
  • Campbell KS, et al. (2004) NKp44 triggers NK cell activation through DAP12 association that is not influenced by a putative cytoplasmic inhibitory sequence. J Immunol. 172(2): 899-906.
  • Hershkovitz O, et al. (2007) Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44. Biochemistry. 46(25): 7426-36.
  • TOP