Rat NCR1 / NK-p46 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_057199.1

RefSeq ORF Size

978bp

Gene Synonym

Ly94, Nkp46, KILR-1, Nk-p46, Ncr1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat natural cytotoxicity triggering receptor 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

References

Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.

Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.

Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.

Catalog Number:HGF166-CY