Mouse NCKIPSD / SPIN90 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGF162-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2145bp
Gene Synonym
DIP1, ORF1, WISH, Wasbp, AF3P21, SPIN90, WASLBP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse NCK interacting protein with SH3 domain Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
NCKIPSD is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. NCKIPSD also plays an important role in stress fiber formation. NCKIPSD gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing occurs in this locus and two transcript variants encoding distinct isoforms have been identified. NCKIPSD is a SH3 domain protein. Fas ligand is a cytotoxic effector molecule of T and NK cells which is characterized by an intracellular N-terminal polyproline region that serves as a docking site for SH3 and WW domain proteins. Several previously described Fas ligand-interacting SH3 domain proteins turned out to be crucial for the regulation of storage, expression and function of the death factor. Recent observations, however, indicate that Fas ligand is also subject to posttranslational modifications including shedding and intramembrane proteolysis.
References
  • Satoh, S, et al. (2001) mDia-interacting protein acts downstream of Rho-mDia and modifies Src activation and stress fiber formation. J Biol Chem. 276(42):39290-4.
  • de Bernard M, et al. (2000) The VacA toxin of Helicobacter pylori identifies a new intermediate filament-interacting protein. EMBO J. 19(1):48-56.
  • Sano K, et al. (2000) Novel SH3 protein encoded by the AF3p21 gene is fused to the mixed lineage leukemia protein in a therapy-related leukemia with t(3;11) (p21;q23). Blood. 95(3): 1066-8.
  • Voss M, et al. (2009) Identification of SH3 domain interaction partners of human FasL (CD178) by phage display screening. BMC Immunol. 10:53.
  • TOP