Mouse N-Cadherin/CD325/CDH2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007664.4

RefSeq ORF Size

2721bp

Gene Synonym

CDHN, Ncad, N-cadherin, Cdh2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cadherin 2 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

References

Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.

Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.

Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.

Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.

Catalog Number:HGF112-CY