Human MTSS1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_014751.4

RefSeq ORF Size

2268bp

Gene Synonym

MIM, MIMA, MIMB, FLJ44694, KIAA0429, DKFZp781P2223, MTSS1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human metastasis suppressor 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

MTSS1 (Metastasis suppressor 1), also known as Missing in metastasis (MIM), is a tissue-specific regulator of plasma membrane dynamics. MTSS1 is well described for its function as a metastasis suppressor gene and is expressed in a variety of tissues. MTSS1 might be involved in shaping neuronal membranes in vivo. MTSS1 deforms phosphoinositide-rich membranes through its I-BAR domain and interacts with actin monomers through its WH2 domain. MTSS1/MIM was first identified as a metastasis suppressor missing in metastatic bladder carcinoma cell lines. MTSS1 is a prognostic indicator of disease-free survival in breast cancer patients and demonstrates the ability to play a role in governing the metastatic nature of breast cancer cells. MTSS1 may serve as a useful biomarker for the prediction of outcome of gastric cancer. The down-regulation of MTSS1 that may be caused by DNA methylation was also observed in many other types of cancer.Recent work proposed that MIM also potentiates Sonic hedgehog (Shh)-induced gene expression. MTSS1 as a multiple functional molecular player and has an important role in development, carcinogenesis and metastasis.

References

Hayn-Leichsenring G, et al. (2011) Cellular distribution of metastasis suppressor 1 and the shape of cell bodies are temporarily altered in Engrailed-2 overexpressing cerebellar Purkinje cells. Neuroscience. 189: 68-78.

Xie F, et al. (2011) MTSS1: a multifunctional protein and its role in cancer invasion and metastasis. Front Biosci (Schol Ed). 3: 621-31.

Saarikangas J, et al. (2011) Missing-in-metastasis MIM/MTSS1 promotes actin assembly at intercellular junctions and is required for integrity of kidney epithelia. J Cell Sci. 2124(Pt 8): 1245-55.

Parr C, et al. (2009) Metastasis suppressor 1 (MTSS1) demonstrates prognostic value and anti-metastatic properties in breast cancer. Eur J Cancer. 45(9): 1673-83.

Catalog Number:HGF062-CM