Human MIF Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGE850-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
393 bp
Gene Synonym
GIF, GLIF, MMIF
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI(6kb+0.39kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Macrophage migration inhibitory factor (MIF) is an immunoregulatory cytokine, the effect of which on arresting random immune cell movement was recognized several decades ago. Despite its historic name, MIF also has a direct chemokine-like function and promotes cell recruitment. MIF is an ubiquitously expressed protein that plays a crucial role in many inflammatory and autoimmune disorders. Increasing evidence suggests that MIF also controls metabolic and inflammatory processes underlying the development of metabolic pathologies associated with obesity. Further research has shown that MIF plays a particularly critical part in cell cycle regulation and therefore in tumorigenesis as well. The significance of the role of MIF in a variety of both solid and hematologic tumors has been established. More recently, interest has increased in the role of MIF in the development of central nervous system (CNS) tumors, in which it appears to influence cell cycle control. MIF contributes to malignant disease progression on several different levels. Both circulating and intracellular MIF protein levels are elevated in cancer patients and MIF expression reportedly correlates with stage, metastatic spread and disease-free survival. Blockade of MIF bioactivity successfully inhibited tumor cell growth in vivo and in vitro. MIF plays important roles in the pathogenesis of gastrointestinal, hepatic, and pancreatic disorders.
References
  • Ohkawara T, et al. (2005) Pathophysiological roles of macrophage migration inhibitory factor in gastrointestinal, hepatic, and pancreatic disorders. J Gastroenterol. 40(2): 117-22.
  • Bach JP, et al.. (2009) The role of macrophage inhibitory factor in tumorigenesis and central nervous system tumors. Cancer. 115(10): 2031-40.
  • Rendon BE, et al.. (2009) Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol. 86(3): 180-5.
  • Grieb G, et al. (2010) Macrophage migration inhibitory factor (MIF): a promising biomarker. Drug News Perspect. 23(4): 257-64.
  • TOP