Human MGAT5 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGE831-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2226bp
Gene Synonym
GNT-V, GNT-VA, MGAT5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.
References
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • TOP