Human Mevalonate kinase / MVK Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGE815-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191bp
Gene Synonym
MK, LRBP, MVLK, POROK3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mevalonate kinase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.
References
  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • TOP