Human METTL11A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGE800-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
672bp
Gene Synonym
AD-003, C9orf32, METTL11A
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human N-terminal Xaa-Pro-Lys N-methyltransferase 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Methyltransferase-like protein 11A, also known as METTL11A, is a member of the methyltransferase superfamily and METTL11 family. Methyltransferase is a type of transferase enzyme which transfers a methyl group from a donor to an acceptor. Methylation often occurs on nucleic bases in DNA or amino acids in protein structures. Methytransferase uses a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. DNA methylation is often utilized to silence and regulate genes without changing the original DNA sequence. This methylation occurs on cytosine residues. DNA methylation may be necessary for normal growth from embryonic stages in mammals. Methylation can serve to protect DNA from enzymatic cleavage, since restriction enzymes are unable to bind and recognize externally modified sequences. This is especially useful in bacterial restriction modification systems which use restriction enzymes to cleave foreign DNA while keeping their own DNA protected by methylation. Methylation of amino acids in the formation of proteins leads to more diversity of possible amino acids and therefore more diversity of function. The methylation reaction occurs on nitrogen atoms either on the N terminus or side-chain position of the protein and are usually irreversible.
References
TOP