Human METAP1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_015143.2

RefSeq ORF Size

1161bp

Gene Synonym

KIAA0094, DKFZp781C0419

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human methionyl aminopeptidase 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Processing of the N-terminal initiator methionine or formylated methionine is an essential cellular process conserved from prokaryotes to eukaryotes. The proteolytic removal of N-terminal methionine from nascent peptides is catalyzed by a family of enzymes known as methionine aminopeptidases (MetAPs) and is essential for cell growth. METAP1 and METAP2 have different substrate specificity due to the differences in both size and shape of the active sites. As a member of the M24 family of metalloproteases, METAP1 plays an important role in G(2)/M phase regulation of the cell cycle and may serve as a promising target for the discovery and development of new anticancer agents.

References

1. Lowther, W.T. and B.W. Matthews, 2000, Biochim. Biophys. Acta. 1477: 157 – 167.

2. Addlaqatta, A. et al., 2005, Biochemistry. 44: 14741-14749.

3. Hu, X. et al., 2006, Proc. Natl. Acad. Sci. U.S.A. 103:18148-18153.

Catalog Number:HGE796-NM