Human MERTK/Mer Gene ORF cDNA clone expression plasmid,without any tag

Catalog Number:HGE791-UT

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3000bp
Gene Synonym
MERTK, MER, RP38, c-mer, MGC133349
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human c-mer proto-oncogene tyrosine kinase Gene ORF cDNA clone expression plasmid,without any tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-untagged
Restriction Site
Protein Tag
Tag Sequence
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
&Proto-oncogene tyrosine-protein kinase MER (MERTK) is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. MERTK is localized in membrane and is no expressed in normal B- and T-lymphocytes but is expressed in numerous neoplastic B- and T-cell lines. This protein is highly expressed in testis, ovary, prostate, lung, and kidney, with lower expression in spleen, small intestine, colon, and liver. MERTK regulates many physiological processes including cell survival, migration, differentiation, and phagocytosis of apoptotic cells (efferocytosis). Ligand binding at the cell surface induces autophosphorylation of MERTK on its intracellular domain that provides docking sites for downstream signaling molecules. MERTK signaling plays a role in various processes such as macrophage clearance of apoptotic cells, platelet aggregation, cytoskeleton reorganization and engulfment. MERTK plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Defects in MERTK are the cause of retinitis pigmentosa type 38.
References
  • Thompson DA, et al. (2002) Retinal dystrophy due to paternal isodisomy for chromosome 1 or chromosome 2, with homoallelism for mutations in RPE65 or MERTK, respectively. Am J Hum Genet. 70 (1): 224-9.
  • Tada A, et al. (2006) Screening of the MERTK gene for mutations in Japanese patients with autosomal recessive retinitis pigmentosa. Mol Vis. 12: 441-4.
  • McHenry CL, et al. (2004) MERTK arginine-844-cysteine in a patient with severe rod-cone dystrophy: loss of mutant protein function in transfected cells. Invest Ophthalmol. Vis Sci. 45 (5): 1456-63.
  • TOP