Human M-CSF/CSF-1 transcript variant 4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_172212.2

RefSeq ORF Size

1665bp

Gene Synonym

MCSF, CSF-1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human colony stimulating factor 1 (macrophage) transcript variant 4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

References

Pandit J. et al., 1992, Science. 258: 1358-62.
Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.

Catalog Number:HGE626-CO