Human LYVE1 / LYVE-1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_006691.3

RefSeq ORF Size

1005 bp

Gene Synonym

CRSBP-1,HAR,LYVE-1,XLKD1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human lymphatic vessel endothelial hyaluronan receptor 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

KpnI + XbaI(6kb+1.01kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

LYVE1, also known as LYVE-1, is a type I integral membrane glycoprotein. It contains 1 Link domain and mainly expressed in endothelial cells lining lymphatic vessels. LYVE1 acts as a receptor and binds to both soluble and immobilized hyaluronan. It may function in lymphatic hyaluronan transport and have a role in tumor metastasis. LYVE1 also is a cell surface receptor on lymphatic endothelial cells that can be used as a lymphatic endothelial cell marker, and sort these cells for experimental purposes. It also functions as a ligand-specific transporter trafficking between intracellular organelles and the plasma membrane. It plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding. It may act as an hyaluronan transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.

References

Jackson DG. (2003) The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med. 13(1):1-7.

Banerji S, et al. (1999) LYVE-1, a new homologue of the CD44 glycoprotein, is a lymph-specific receptor for hyaluronan. J Cell Biol. 144(4):789-801.

Mouta Carreira C, et al. (2001) LYVE-1 is not restricted to the lymph vessels: expression in normal liver blood sinusoids and down-regulation in human liver cancer and cirrhosis. Cancer Res. 61(22): 8079-84.

Cursiefen C, et al. (2002) Lymphatic vessels in vascularized human corneas: immunohistochemical investigation using LYVE-1 and podoplanin. Invest Ophthalmol Vis Sci. 43(7):2127-35.

Catalog Number:HGE617-NY