Human LRRTM4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_001134745.1

RefSeq ORF Size

1773bp

Gene Synonym

FLJ12568, MGC120633, MGC120636, LRRTM4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human leucine rich repeat transmembrane neuronal 4 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leucine-rich repeat transmembrane neuronal protein 4, also known as LRRTM4, is a single-pass type I membrane protein which belongs to the LRRTM family. LRRTM4 is expressed in the limb mesenchyme, neural tube, caudal mesoderm and in three distinct regions of the head. LRRTM4 may play a role in the development and maintenance of the vertebrate nervous system. Leucine-rich repeat containing proteins are involved in protein-protein interactions and they regulate numerous cellular events during nervous system development and disease. Human and mouse LRRTMs are highly conserved, and orthologous genes exist in other vertebrates but not in invertebrates. LRRTM mRNAs are predominantly expressed in the nervous system and that each LRRTM possesses a specific, partially nonoverlapping expression pattern. The structure and expression profile of LRRTM mRNAs suggest that they may have a role in the development and maintenance of the vertebrate nervous system. All LRRTMs, except LRRTM4, are located in the introns of different alpha-catenin genes, suggesting coevolution of these two gene families.

References

Laurén,J. et al., 2003, Genomics 81 (4):411-21.

Clark HF. et al.,2003, Genome Res. 13: 2265-70.

Haines,BP. et al., 2007,Gene Expr Patterns 7 (1-2): 23-9.

Catalog Number:HGE564-NO