Human LRRN3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC035133.2

RefSeq ORF Size

2127bp

Gene Synonym

NLRR3, NLRR-3, FIGLER5, FLJ11129, LRRN3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human leucine rich repeat neuronal 3 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Leucine-rich repeat neuronal protein 3, also known as neuronal leucine-rich repeat protein 3 (NLRR-3), is a member of leucine-rich (LRR) family whose members have significant functions in neural development. Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. All proteins containing these repeats are thought to be involved in protein-protein interactions. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged so that they form a parallel β-sheet with one surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two features may be responsible for the protein-binding functions of proteins containing leucine-rich repeats. LRRN3 plays an important role in cerebellum postnatal development. In a unilateral cortical injury cerebral cortex, NLRR-3 mRNA increased in layers 2-3 which suggests that NLRR-3 may be an important component of the pathophysiological response to brain injury.

References

Yang J, et al. (2011) Role of LRRN3 in the cerebellum postnatal development in rats. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36 (5): 424-9.

Hutcheson HB, et al. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med Genet. 5: 12.

Ishii N, et al. (1996) Increased expression of NLRR-3 mRNA after cortical brain injury in mouse. Brain Res Mol Brain Res. 40 (1): 148-52.

Catalog Number:HGE560-CF