Mouse LRPAP1/A2MRAP Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_013587.2

RefSeq ORF Size

1083bp

Gene Synonym

RAP, HBP44, C77774, AA617339, AI790446, AU042172, Lrpap1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse low density lipoprotein receptor-related protein associated protein 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 330), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).

References

Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.

Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?

Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.

Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.

Catalog Number:HGE539-CF