Human LILRA3/CD85e/ILT6 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGE362-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1320bp
Gene Synonym
e3, HM31, HM43, ILT6, LIR4, CD85E, LIR-4, LILRA3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ILT6, also known as LILRA3, belongs to the ILT family. In human, the ILT gene family includes up to 11 members. The extracellular portion of all members includes at least two and usually four immuno-globulin domains. ILT-2 through 5 are all inhibitory members having variable numbers of cytoplasmic ITIM domains. ILT6 lacks a transmembrane domain. The function of ILT6 is currently unknown. however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the ILT6 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease.
References
  • Wi?niewski A, et al. (2004) Distribution of LILRA3 (ILT6 / LILRA3/LIR4) deletion in psoriatic patients and healthy controls. Hum Immunol. 64(4):458-61.
  • Norman PJ, et al. (2003) DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3. Immunogenetics. 55(3):165-71.
  • Cella M, et al. (1997) A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 185(10): 1743-51.
  • TOP