Rat LAMP-1/CD107a/LAMP1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_012857.1

RefSeq ORF Size

1224bp

Gene Synonym

LGP120, Lamp1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat lysosomal-associated membrane protein 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lysosome-associated membrane glycoprotein 1, also known as CD107 antigen-like family member A, CD107a, and LAMP1, is a single-pass type I membrane protein which belongs to the LAMP family. CD107a is expressed largely in the endosome-lysosome membranes of cells, but is also found on the plasma membrane (1-2% of total LAMP1). LAMP1 has been implicated in a variety of cellular functions, including cancer metastasis. It has been proposed LAMP1 serves as a therapeutic agent for some cancers, as well as a marker for lysosomal storage disorders and different cell types such as cytotoxic T cells. LAMP2, also known as CD107b, may also play a role in tumor cell metastasis and functions in the protection, maintenance, and adhesion of the lysosome. Cell surface LAMP1 and LAMP2 have been shown to promote adhesion of human peripheral blood mononuclear cells (PBMC) to vascular endothelium, therefore they are possibly involved in the adhesion of PBMCs to the site of inflammation. LAMP-1 is a glycoprotein highly expressed in lysosomal membranes. The present study was initiated to test LAMP-1 mRNA and protein levels in post mortem frontal cortex (area 8) of Alzheimer's disease (AD) stages I-IIA/B and stages V-VIC of Braak and Braak, compared with age-matched controls. LAMP-1 occurred in microglia and multinucleated giant cells in one AD case in whom amyloid burden was cleared following betaA-peptide immunization. In addition, LAMP-1 has been suggested to be a cell surface receptor for a specific amelogenin isoform, leucine-rich amelogenin peptide or LRAP. LAMP-1 can serve as a cell surface binding site for amelogenin on dental follicle cells and cementoblasts.

References

Parkinson-Lawrence EJ, et al. (2005) Immunochemical analysis of CD107a (LAMP-1). Cell Immunol. 236(1-2): 161-6.

Barrachina M, et al. (2006) Lysosome-associated membrane protein 1 (LAMP-1) in Alzheimer's disease. Neuropathol Appl Neurobiol. 32(5): 505-16.

Zhang H, et al. (2010) Full length amelogenin binds to cell surface LAMP-1 on tooth root/periodontium associated cells. Arch Oral Biol. 55(6): 417-25.

Catalog Number:HGE277-NF