Mouse Lactotransferrin/LTF Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_008522.3

RefSeq ORF Size

2124bp

Gene Synonym

Lf, Csp82, Ms10r, MMS10R, Ltf

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse lactotransferrin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lactotransferrin, also known as Lactoferrin, Talalactoferrin and LTF, is a secreted protein which belongs to the transferrin family. Transferrins are iron binding transport proteins which can bind two Fe³⁺ ions in association with the binding of an anion, usually bicarbonate. Lactotransferrin has antimicrobial activity which depends on the extracellular cation concentration. Lactoferroxins A, B and C have opioid antagonist activity. Lactoferroxin A shows preference for mu-receptors, while lactoferroxin B and lactoferroxin C have somewhat higher degrees of preference for kappa-receptors than for mu-receptors. Lactoferrin / LTF is a globular glycoprotein that is widely represented in various secretory fluids, such as milk, saliva, tears, and nasal secretions. Lactoferrin / LTF is also present in secondary granules of PMN and is secreted by some acinar cells. Lactoferrin / LTF can be purified from milk or produced recombinantly. Human colostrum has the highest concentration, followed by human milk, then cow milk. Lactoferrin / LTF is one of the components of the immune system of the body; it has antimicrobial activity (bacteriocide, fungicide) and is part of the innate defense, mainly at mucoses. In particular, lactoferrin provides antibacterial activity to human infants. Lactoferrin interacts with DNA and RNA, polysaccharides and heparin, and shows some of its biological functions in complexes with these ligands.

References

Sánchez L, et al.,1992, Arch. Dis. Child. 67 (5): 657 - 61.

Wakabayashi H, et al., 2000, J. Antimicrob. Chemother. 46 (4): 595-602.

Nozaki A, et al., 2003, J. Biol. Chem. 278 (12): 10162-73.

Azzam HS, et al., 2007, Liver Int. 27 (1): 17-25.

Catalog Number:HGE268-CF