Mouse KLK6/Kallikrein 6/Neurosin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_011177.1

RefSeq ORF Size

741bp

Gene Synonym

Bssp, Klk7, Klk29, Prss9, Prss18, AI849898, neurosin, Klk6

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse kallikrein related-peptidase 6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

KLK6 (kallikrein-related peptidase 6), also known as Klk7, belongs to the peptidase S1 family, Kallikrein subfamily. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. KLK6 is a serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Klk7 shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. KLK6 degrades alpha-synuclein and prevents its polymerization, indicating that KLK6 may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. Klk7 may be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis.

References

Krenzer S, et al. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol. 131(11):2281-8.

Nathalie HV, et al. (2009) High kallikrein-related peptidase 6 in non-small cell lung cancer cells: an indicator of tumour proliferation and poor prognosis. J Cell Mol Med. 13(9B):4014-22.

Kim JT, et al. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer. 117(12):2608-19.

Scarisbrick IA, et al. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One. 6(3):e18376.

Catalog Number:HGE203-CY