Human KIR2DL3 (CD158b2) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGE164-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1026bp
Gene Synonym
p58, NKAT, GL183, NKAT2, CD158b, NKAT2A, NKAT2B, CD158B2, KIR-K7b, KIR-K7c, KIRCL23, KIR-023GB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Killer cell immunoglobulin-like receptor 2DL3, also known as CD158 antigen-like family member B2, KIR-023GB, Killer inhibitory receptor cl 2-3, MHC class I NK cell receptor, NKAT2a, NKAT2b, Natural killer-associated transcript 2, p58 natural killer cell receptor clone CL-6, p58.2 MHC class-I-specific NK receptor, CD158b2 and KIR2DL3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. KIR2DL3 contains 2 Ig-like C2-type (immunoglobulin-like) domains. KIR2DL3 interacts with ARRB2. KIR2DL3 is a receptor on natural killer (NK) cells for HLA-C alleles (HLA-Cw1, HLA-Cw3 and HLA-Cw7). KIR2DL3 inhibits the activity of NK cells thus preventing cell lysis.
References
  • Selvakumar A., et al., 1997, Immunol. Rev. 155:183-196.
  • Wilson M.J., et al., 1997, Tissue Antigens 49:574-579.
  • Maenaka K., et al., 1999, Structure 7:391-398.
  • Vitale,M. et al., 2004, Int Immunol. 16 (10):1459-66.
  • Yu M.-C., et al., 2008, Nat. Immunol. 9:898-907.
  • TOP