Human KIAA0101/p15 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_014736.4

RefSeq ORF Size

336bp

Gene Synonym

L5, PAF, OEATC1, NS5ATP9, OEATC-1, p15(PAF), KIAA0101

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human platelet-activating factor Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

References

Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.

Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.

Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.

Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.

Catalog Number:HGE146-CF