Rat IZUMO4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGE067-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
684bp
Gene Synonym
RGD1564722
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat IZUMO family member 4 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Co-immunoprecipitation studies showed the presence of other sperm proteins associated with Izumo 1, suggesting Izumo 1 forms a multiprotein membrane complex.
References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ellerman DA, et al. (2009) Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol Reprod Dev. 76(12):1188-99.
  • TOP