Rat IL7R/IL-7R/CD127 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGD960-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1374bp
Gene Synonym
Il7r
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 7 receptor Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 7 Receptor alpha (IL-7RA), also known as CD127, is a 75 kDa hematopoietin receptor superfamily member that plays an important role in lymphocyte differentiation, proliferation, and survival. IL-7 receptor alpha (CD127) signaling is essential for T-cell development and regulation of naive and memory T-cell homeostasis. IL-7RA is critically required for the proper development and function of lymphoid cells. Therefore, the IL-7RA is critically required for the proper development and function of lymphoid cells. Studies from both pathogenic and controlled HIV infection indicate that the containment of immune activation and preservation of CD127 expression are critical to the stability of CD4(+) T cells in infection. A better understanding of the factors regulating CD127 expression in HIV disease, particularly on T(CM) cells, might unveil new approaches exploiting the IL-7/IL-7R receptor pathway to restore T cell homeostasis and promote immune reconstitution in HIV infection. Factors relevant to HIV infection that could potentially decrease CD127 expression on human CD8(+) T cells. CD127 down-regulation may be an important contributor to HIV-associated T-cell dysfunction. In addition to IL-7, IL-7RA also associates with TSLPR to form the functional receptor for thymic stromal lymphopoietin (TSLP) which indirectly regulates T cell development by modulating dendritic cell activation. Mutations in the human IL-7RA gene cause a type of severe combined immunodeficiency in which the major deficiencies are in T cell development, whereas B and NK cells are relatively normal in number. Variation in the IL7RA gene was recently found associated with multiple sclerosis (MS). The polymorphisms in the IL7RA gene is involved in MS pathogenesis and suggest that IL7RA variation may primarily affect chronic disease courses. Soluble CD127 (sCD127) appears to play an important role in the immunopathogenesis of several chronic infections, multiple sclerosis, and various cancers.
References
  • Vranjkovic A, et al. (2007) IL-7 decreases IL-7 receptor alpha (CD127) expression and induces the shedding of CD127 by human CD8+ T cells. Int Immunol. 19(12): 1329-39.
  • Kiazyk SA, et al. (2008) Loss of CD127 expression links immune activation and CD4(+) T cell loss in HIV infection. Trends Microbiol. 16(12): 567-73.
  • Akkad DA, et al. (2009) Variation in the IL7RA and IL2RA genes in German multiple sclerosis patients. J Autoimmun. 32(2): 110-5.
  • Crawley AM, et al. (2010) Soluble IL-7R alpha (sCD127) inhibits IL-7 activity and is increased in HIV infection. J Immunol. 184(9): 4679-87.
  • TOP