Human IL11RA/IL-11RA transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGD913-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1269bp
Gene Synonym
IL11RA, MGC2146
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 11 receptor, alpha (IL11RA), transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of the hematopoietic cytokine receptor family. IL11RA/IL-11RA is expressed in a number of cell lines, including the myelogenous leukemia cell line K562, the megakaryocytic leukemia cell line Mo7E, the erythroleukemia cell line TF1, and the osteosarcoma cell lines, MG-63 and Saos-2. It is also expressed in normal and malignant prostate epithelial cell lines. Expression levels are increased in prostate carcinoma. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus, and three variants encoding two different isoforms have been identified. IL11RA/IL-11RA is a receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. Defects in IL11RA/IL-11RA are a cause of craniosynostosis and dental anomalies (CRSDA). CRSDA is a disorder characterized by craniosynostosis, maxillary hypoplasia, and dental anomalies, including malocclusion, delayed and ectopic tooth eruption, and/or supernumerary teeth. Some patients also display minor digit anomalies, such as syndactyly and/or clinodactyly.
References
  • Van Leuven F, et al. (1996) Molecular cloning and characterization of the human interleukin-11 receptor alpha-chain gene, IL11RA, located on chromosome 9p13. Genomics. 31 (1): 65-70.
  • Yoshizaki A, et al. (2006) Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the invasive and proliferative activity of human colorectal carcinoma cells. Int J Oncol. 29 (4): 869-76.
  • Karube K, et al. (2006) Gene expression profile of cytokines and chemokines in microdissected primary Hodgkin and Reed-Sternberg (HRS) cells: high expression of interleukin-11 receptor alpha. Ann Oncol. 17 (1): 110-6.
  • TOP