Mouse IGFBP6 / IBP6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGD845-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
717bp
Gene Synonym
IGFBP-6, Igfbp6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse insulin-like growth factor binding protein 6 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.
References
  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • TOP