Human IGF2BP2/IMP2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_006548.4

RefSeq ORF Size

1800bp

Gene Synonym

p62, IMP2, IMP-2, VICKZ2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human insulin-like growth factor 2 mRNA binding protein 2 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

References

Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.

Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.

Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.

Catalog Number:HGD838-CM