Human ICAM4 / CD242 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGD781-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
819bp
Gene Synonym
LW, CD242, ICAM4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ?intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)? Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ICAM4, also known as CD242, is a member of the?immunoglobulin superfamily, ICAM family. ICAM4 contains 2?Ig-like C2-type (immunoglobulin-like) domains. It is similar to the intercellular adhesion molecule (ICAM) protein family. ICAM4 binds to the leukocyte adhesion LFA-1 protein. ICAM4's first reported receptors were CD11a/CD18 and CD11b/CD18. ICAM4 functions as a ligand for the monocyte/macrophage-specific CD11c/CD18. Deletion of the individual immunoglobulin domains of ICAM4 demonstrated that both its domains contain binding sites for CD11c/CD18. CD11c/CD18 is expressed on macrophages in spleen and bone marrow. Inhibition of erythrophagocytosis by anti-ICAM4 and anti-integrin antibodies suggests a role for these interactions in removal of senescent red cells.
References
  • Gorst DW. et al., 1980, Vox Sanguinis. 38 (2): 99-105.
  • Vos GH. et al., 1973, Blood. 42 (3): 445-53.
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Daniels G. et al., 2002, Transfusion Medicine. 12 (5): 287-95.
  • TOP