Rat HSPA8/HSC70 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:HGD750-CG

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1986 bp
Gene Synonym
Hsc70
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat heat shock 70kDa protein 8 Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
KpnI + XbaI(6kb+1.99kb)
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.
References
  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • TOP