Human HSF1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC014638

RefSeq ORF Size

1590bp

Gene Synonym

HSTF1, HSF1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human heat shock transcription factor 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Heat shock factor protein 1, also known as heat shock transcription factor 1, HSF1 and HSTF1, is a cytoplasm and nucleus protein which belongs to the HSF family. HSF1 is the major transcription factor of HSPs (heat shock proteins) in response to various stresses. Wild type HSF1 (heat shock transcriptional factor 1) is normally inactive. HSF1 / HSTF1 is a DNA-binding protein that specifically binds heat shock promoter elements (HSE) and activates transcription. In higher eukaryotes, HSF is unable to bind to the HSE unless the cells are heat shocked. HSF1 / HSTF1 protects cells and organisms against various types of stress, either by triggering a complex response that promotes cell survival or by triggering cell death when stress-induced alterations cannot be rescued. HSF1 / HSTF1 is the key protein in regulating stress response. It can be activated under heat, oxidative or another stress conditions. Dominant-positive and dominant-negative HSF1 are two types of HSF1 mutants. Both of them gain the DNA binding activity in the absence of stress. In addition, dominant-positive HSF1 acquires transcriptional activity, which dominant-negative HSF1 does not acquire. HSF1 / HSTF1 was also reported to contribute to cell resistance against genotoxic stress, such as that caused by doxorubicin, an anticancer drug in common clinical use.

References

Holmberg,C.I. et al., 2000, Cell Stress Chaperones.5 (3):219-28.

Huang,Y.H. et al., 2007, Sheng Wu Gong Cheng Xue Bao. 23 (6): 971-5.

Salmand,P.A. et al.,2008, Biol Reprod 79 (6): 1092-101.

Lee,Y.J. et al., 2008, Cancer Res 68 (18): 7550-60.

Hou,Y. et al., 2009, Mol Biol Rep. 36 (8): 2271-7.

Catalog Number:HGD733-NY