Mouse HMGN3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_175074.2

RefSeq ORF Size

234bp

Gene Synonym

TRIP7; BB071015; 1110002A15Rik; 6330514M13Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 3 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.

References

Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.

Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.

Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.

Catalog Number:HGD655-CM