Human HER2/ERBB2 transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGD549-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3768bp
Gene Synonym
ErbB2, NEU, NGL, HER2, TKR1, CD340, HER-2, c-erbB2, HER-2/neu, p185erbB2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian), transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
HindIII + XbaI (6kb + 3.82kb)
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.
References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • TOP