Mouse HDAC3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGD506-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1287bp
Gene Synonym
AW537363
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse histone deacetylase 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Histone Deacetylases (HDACs) are a group of enzymes closely related to sirtuins. They catalyze the removal of acetyl groups from lysine residues in histones and non-histone proteins, resulting in transcriptional repression. In general, they do not act autonomously but as components of large multiprotein complexes, such as pRb-E2F and mSin3A, that mediate important transcription regulatory pathways. There are three classes of HDACs; classes 1, 2 and 4, which are closely related Zn2+-dependent enzymes. HDACs are ubiquitously expressed and they can exist in the nucleus or cytosol. Their subcellular localization is effected by protein-protein interactions (for example HDAC-14.3.3 complexes are retained in the cytosol) and by the class to which they belong (class 1 HDACs are predominantly nuclear whilst class 2 HDACs shuttle between the nucleus and cytosol). HDACs have a role in cell growth arrest, differentiation and death and this has led to substantial interest in HDAC inhibitors as possible antineoplastic agents. Histone Deacetylases (HDACs) is Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Probably participates in the regulation of transcription through its binding to the zinc-finger transcription factor YY1; increases YY1 repression activity. Required to repress transcription of the POU1F1 transcription factor. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation.
References
  • Emiliani S, et al. (1998) Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci. 95 (6): 2795-800.
  • Dangond F, et al. (1998) Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells. Biochem Biophys Res Commun. 242 (3): 648-52.
  • Nicolas E, et al. (2001) The histone deacetylase HDAC3 targets RbAp48 to the retinoblastoma protein. Nucleic Acids Res. 29 (15): 3131-6.
  • TOP